Exemples from (Mycobacterium tuberculosis) :
name1,GAGAAACAGGAGGGCGTTG,TATTACGACGACCGCTATGC
name2,CGTGCACAGTTGGGTGTTTA,TTCGTTCAGGAACTCCAAGG

1. Edit or Paste primer(s):

input format: name, primer_left, primer_right

Validate primer form

2. Taxon(s) selected:

3. Search in:

use :